Transcript: Mouse XM_011240080.2

PREDICTED: Mus musculus glutamyl-tRNA(Gln) amidotransferase, subunit B (Gatb), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gatb (229487)
Length:
1773
CDS:
144..1664

Additional Resources:

NCBI RefSeq record:
XM_011240080.2
NBCI Gene record:
Gatb (229487)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240080.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426010 ACTCGTTCATTTGATTATAAG pLKO_005 924 CDS 100% 13.200 18.480 N Gatb n/a
2 TRCN0000421173 CTCAGCAGGTGATCAATATTG pLKO_005 1066 CDS 100% 13.200 10.560 N Gatb n/a
3 TRCN0000229355 TGAGAGTGGATGCCAATATAT pLKO_005 760 CDS 100% 15.000 10.500 N GATB n/a
4 TRCN0000429374 ACTTGACCTACTGTATCTATC pLKO_005 478 CDS 100% 10.800 7.560 N Gatb n/a
5 TRCN0000427013 ATTTGAACAGAGCCGGAATTG pLKO_005 613 CDS 100% 10.800 7.560 N Gatb n/a
6 TRCN0000430277 GGTGTCAGGACTGAGGTAAAG pLKO_005 807 CDS 100% 10.800 7.560 N Gatb n/a
7 TRCN0000103342 CCAAAGCCATAGATTATGAAA pLKO.1 853 CDS 100% 5.625 3.938 N Gatb n/a
8 TRCN0000103343 GCACAGCTTTGCGTTACTGAA pLKO.1 1166 CDS 100% 4.950 3.465 N Gatb n/a
9 TRCN0000103344 CGGAAGCACTACTTCTACTCA pLKO.1 399 CDS 100% 3.000 2.100 N Gatb n/a
10 TRCN0000103341 CCACATAAACAAGAAGTCCTT pLKO.1 371 CDS 100% 2.640 1.848 N Gatb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240080.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.