Transcript: Mouse XM_011240139.1

PREDICTED: Mus musculus fibronectin type III domain containing 7 (Fndc7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fndc7 (320181)
Length:
2255
CDS:
303..2225

Additional Resources:

NCBI RefSeq record:
XM_011240139.1
NBCI Gene record:
Fndc7 (320181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248389 CCGGAACTCTCTACACTATAA pLKO_005 817 CDS 100% 13.200 18.480 N Fndc7 n/a
2 TRCN0000191193 CCTATCAAAGTTACTCTTCTA pLKO.1 2161 CDS 100% 4.950 3.960 N Fndc7 n/a
3 TRCN0000248388 GTGGAGCTGGGTGACTATTAT pLKO_005 1230 CDS 100% 15.000 10.500 N Fndc7 n/a
4 TRCN0000248386 CAACTACACGGTGGCGTTAAA pLKO_005 2105 CDS 100% 13.200 9.240 N Fndc7 n/a
5 TRCN0000248387 GAGTCCTCTGGGCGATGTATT pLKO_005 1379 CDS 100% 13.200 9.240 N Fndc7 n/a
6 TRCN0000192864 GCCTATCAAAGTTACTCTTCT pLKO.1 2160 CDS 100% 4.950 3.465 N Fndc7 n/a
7 TRCN0000149363 GCATCACATGTGGCATCAATT pLKO.1 2089 CDS 100% 13.200 9.240 N FNDC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.