Transcript: Mouse XM_011240385.1

PREDICTED: Mus musculus phosphopantothenoylcysteine synthetase (Ppcs), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppcs (106564)
Length:
973
CDS:
186..530

Additional Resources:

NCBI RefSeq record:
XM_011240385.1
NBCI Gene record:
Ppcs (106564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198413 GTTAAGGATCAACACAGTGAA pLKO.1 598 3UTR 100% 4.950 2.970 N Ppcs n/a
2 TRCN0000276962 CCAACATCCTGGAGTCAATAA pLKO_005 364 CDS 100% 13.200 6.600 Y Ppcs n/a
3 TRCN0000276964 GACAGACCCGGACATCATAAT pLKO_005 293 CDS 100% 13.200 6.600 Y Ppcs n/a
4 TRCN0000177469 GTGATAGAAGAGAAGATAGTA pLKO.1 462 CDS 100% 5.625 2.813 Y Ppcs n/a
5 TRCN0000277018 GTGATAGAAGAGAAGATAGTA pLKO_005 462 CDS 100% 5.625 2.813 Y Ppcs n/a
6 TRCN0000182784 CCAGAGCTCTTACCACTGATA pLKO.1 557 3UTR 100% 4.950 2.475 Y Ppcs n/a
7 TRCN0000277016 CCAGAGCTCTTACCACTGATA pLKO_005 557 3UTR 100% 4.950 2.475 Y Ppcs n/a
8 TRCN0000182419 GCTCGGAATGCTTTGGAAGTT pLKO.1 321 CDS 100% 4.950 2.475 Y Ppcs n/a
9 TRCN0000177504 CCTTTGTGATTATTGTAACCA pLKO.1 388 CDS 100% 3.000 1.500 Y Ppcs n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.