Transcript: Mouse XM_011240759.2

PREDICTED: Mus musculus TBC1 domain family, member 1 (Tbc1d1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d1 (57915)
Length:
1758
CDS:
16..1479

Additional Resources:

NCBI RefSeq record:
XM_011240759.2
NBCI Gene record:
Tbc1d1 (57915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111173 GCCACGGTAGAGAAACTTCTT pLKO.1 1309 CDS 100% 4.950 6.930 N Tbc1d1 n/a
2 TRCN0000315556 GCCACGGTAGAGAAACTTCTT pLKO_005 1309 CDS 100% 4.950 6.930 N Tbc1d1 n/a
3 TRCN0000304917 CAGGGATCAGAGGTCATATTT pLKO_005 949 CDS 100% 15.000 10.500 N Tbc1d1 n/a
4 TRCN0000311163 TATCGGCCAGACATGATTATT pLKO_005 748 CDS 100% 15.000 10.500 N Tbc1d1 n/a
5 TRCN0000304916 GAAGAGACTGTGCACCATTAA pLKO_005 1489 3UTR 100% 13.200 9.240 N Tbc1d1 n/a
6 TRCN0000111172 CGTGTCTTAAAGAAGTCACTA pLKO.1 266 CDS 100% 4.950 3.465 N Tbc1d1 n/a
7 TRCN0000308376 CGTGTCTTAAAGAAGTCACTA pLKO_005 266 CDS 100% 4.950 3.465 N Tbc1d1 n/a
8 TRCN0000111170 GAGGCAGAGAAGAGAGAACTT pLKO.1 1546 3UTR 100% 4.950 2.970 N Tbc1d1 n/a
9 TRCN0000147724 GTGACAACCAAAGAATGGATA pLKO.1 1196 CDS 100% 4.950 3.465 N TBC1D1 n/a
10 TRCN0000318878 GTGACAACCAAAGAATGGATA pLKO_005 1196 CDS 100% 4.950 3.465 N TBC1D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.