Transcript: Mouse XM_011241012.2

PREDICTED: Mus musculus zinc finger with KRAB and SCAN domains 14 (Zkscan14), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zkscan14 (67235)
Length:
1624
CDS:
267..1430

Additional Resources:

NCBI RefSeq record:
XM_011241012.2
NBCI Gene record:
Zkscan14 (67235)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304551 CAGAGCGCCACCCTCATTAAA pLKO_005 1293 CDS 100% 15.000 12.000 N Zkscan14 n/a
2 TRCN0000304552 GCCAGTGAGAAGTACTATAAA pLKO_005 1080 CDS 100% 15.000 10.500 N Zkscan14 n/a
3 TRCN0000085204 CCAGGAAGACAAACCTTACAA pLKO.1 827 CDS 100% 5.625 3.938 N Zkscan14 n/a
4 TRCN0000301905 CCAGGAAGACAAACCTTACAA pLKO_005 827 CDS 100% 5.625 3.938 N Zkscan14 n/a
5 TRCN0000085205 GACACCAAAGAATCCATCAAA pLKO.1 1396 CDS 100% 5.625 3.938 N Zkscan14 n/a
6 TRCN0000085203 TGTTGTTGCTACTGTTGAGAA pLKO.1 1465 3UTR 100% 4.950 3.465 N Zkscan14 n/a
7 TRCN0000301940 TGTTGTTGCTACTGTTGAGAA pLKO_005 1465 3UTR 100% 4.950 3.465 N Zkscan14 n/a
8 TRCN0000085207 ACAAGAAGTATCCCAGGGAAT pLKO.1 464 CDS 100% 4.050 2.835 N Zkscan14 n/a
9 TRCN0000085206 GATGTGATTCTAAAGCAGGAA pLKO.1 411 CDS 100% 2.640 1.848 N Zkscan14 n/a
10 TRCN0000304550 TCAATGTGGTGAAAGATTTAG pLKO_005 1355 CDS 100% 13.200 7.920 N Zkscan14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.