Transcript: Mouse XM_011241021.3

PREDICTED: Mus musculus relaxin/insulin-like family peptide receptor 2 (Rxfp2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Rxfp2 (140498)
Length:
3678
CDS:
110..2332

Additional Resources:

NCBI RefSeq record:
XM_011241021.3
NBCI Gene record:
Rxfp2 (140498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241538 ATCAGCTTGCTTGGCTAATTT pLKO_005 693 CDS 100% 15.000 21.000 N Rxfp2 n/a
2 TRCN0000217275 CGTTCACCAGAGAGGATTATT pLKO.1 1734 CDS 100% 15.000 21.000 N Rxfp2 n/a
3 TRCN0000241537 ACTGGACCTGTCTAGCAATAT pLKO_005 994 CDS 100% 13.200 18.480 N Rxfp2 n/a
4 TRCN0000241540 TCCGGTGAACAGCGCCTTAAA pLKO_005 2107 CDS 100% 13.200 18.480 N Rxfp2 n/a
5 TRCN0000174897 GCCTAGAAATCAAATTGGTTT pLKO.1 931 CDS 100% 4.950 6.930 N Rxfp2 n/a
6 TRCN0000215516 GAAGTTCCTTGTCATAGTATT pLKO.1 1624 CDS 100% 13.200 10.560 N Rxfp2 n/a
7 TRCN0000176238 GAATGTGTAAAGGCTGACTTA pLKO.1 434 CDS 100% 4.950 3.960 N Rxfp2 n/a
8 TRCN0000241539 AGTGGATGGACAACCATATTT pLKO_005 317 CDS 100% 15.000 10.500 N Rxfp2 n/a
9 TRCN0000241541 TGCCGTCGACTGATGGTATTT pLKO_005 1266 CDS 100% 13.200 9.240 N Rxfp2 n/a
10 TRCN0000194580 CCTGTGGGAATCTCACCAAAT pLKO.1 219 CDS 100% 10.800 7.560 N Rxfp2 n/a
11 TRCN0000009005 CGAGGGCAGTATCAGAAGTAT pLKO.1 1502 CDS 100% 5.625 3.938 N RXFP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.