Transcript: Mouse XM_011241053.2

PREDICTED: Mus musculus transcription factor EC (Tfec), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tfec (21426)
Length:
4287
CDS:
257..1261

Additional Resources:

NCBI RefSeq record:
XM_011241053.2
NBCI Gene record:
Tfec (21426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085608 GCTTTCACTTAACTCTCTGAA pLKO.1 1342 3UTR 100% 4.950 3.960 N Tfec n/a
2 TRCN0000085611 CCAAGTATTCTACCCATGAGA pLKO.1 626 CDS 100% 3.000 2.400 N Tfec n/a
3 TRCN0000085610 GTGCTGAGAAATGGCATTTAT pLKO.1 528 CDS 100% 15.000 10.500 N Tfec n/a
4 TRCN0000229449 GTGCTGAGAAATGGCATTTAT pLKO_005 528 CDS 100% 15.000 10.500 N Tfec n/a
5 TRCN0000229451 ATGCTACTAAGTGATACAATA pLKO_005 1139 CDS 100% 13.200 9.240 N Tfec n/a
6 TRCN0000229452 CAGTGACATGCTAGGATATTG pLKO_005 1558 3UTR 100% 13.200 9.240 N Tfec n/a
7 TRCN0000218772 GAACAAAGGGACCATTCTAAA pLKO_005 748 CDS 100% 13.200 9.240 N Tfec n/a
8 TRCN0000229450 GATGCTCCTTGTCCAAGTATT pLKO_005 614 CDS 100% 13.200 9.240 N Tfec n/a
9 TRCN0000085612 CCATTGTCTCACTTCACAGAT pLKO.1 1073 CDS 100% 4.950 3.465 N Tfec n/a
10 TRCN0000085609 GCCGCTTTGAAAGAGGAACAA pLKO.1 1106 CDS 100% 4.950 3.465 N Tfec n/a
11 TRCN0000016100 CCAAAGTCTAATGATCCTGAT pLKO.1 719 CDS 100% 4.050 2.835 N TFEC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.