Transcript: Mouse XM_011241084.1

PREDICTED: Mus musculus carboxypeptidase A5 (Cpa5), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpa5 (74649)
Length:
2151
CDS:
602..1810

Additional Resources:

NCBI RefSeq record:
XM_011241084.1
NBCI Gene record:
Cpa5 (74649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435095 CTCATAGCATGAACCGCTTAT pLKO_005 1236 CDS 100% 10.800 15.120 N Cpa5 n/a
2 TRCN0000221977 TGCAACTTTATCTTGGCTGTA pLKO.1 671 CDS 100% 4.050 5.670 N Cpa5 n/a
3 TRCN0000221975 CCATGTCTTGAAGAGGATATT pLKO.1 1159 CDS 100% 13.200 10.560 N Cpa5 n/a
4 TRCN0000221973 CGGAGGAAATGGTTCTAACAA pLKO.1 1333 CDS 100% 5.625 4.500 N Cpa5 n/a
5 TRCN0000221974 GCCCAGTGTTAAAGCTTATTT pLKO.1 868 CDS 100% 15.000 10.500 N Cpa5 n/a
6 TRCN0000428751 CATCAGCACCACCCTCTATTC pLKO_005 1606 CDS 100% 10.800 7.560 N Cpa5 n/a
7 TRCN0000221976 GATGGCATTACAGACCATCAT pLKO.1 1762 CDS 100% 0.495 0.347 N Cpa5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.