Transcript: Mouse XM_011241323.2

PREDICTED: Mus musculus C-type lectin domain family 12, member a (Clec12a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clec12a (232413)
Length:
1266
CDS:
109..912

Additional Resources:

NCBI RefSeq record:
XM_011241323.2
NBCI Gene record:
Clec12a (232413)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249251 GTACAAGAAGCTACGCTATTT pLKO_005 651 CDS 100% 13.200 18.480 N Clec12a n/a
2 TRCN0000249249 TCGCACACAATATCCACTAAG pLKO_005 699 CDS 100% 10.800 15.120 N Clec12a n/a
3 TRCN0000215556 GATAAGAAGTACTGCGGATAT pLKO.1 769 CDS 100% 10.800 8.640 N Clec12a n/a
4 TRCN0000215850 CAAGGATGTGCTGGAATTTAT pLKO.1 627 CDS 100% 15.000 10.500 N Clec12a n/a
5 TRCN0000249252 CAAGGATGTGCTGGAATTTAT pLKO_005 627 CDS 100% 15.000 10.500 N Clec12a n/a
6 TRCN0000249250 TAAGAAGTACTGCGGATATAT pLKO_005 771 CDS 100% 15.000 10.500 N Clec12a n/a
7 TRCN0000183929 CCATGTCCAAAGGGTTCAGAA pLKO.1 502 CDS 100% 4.950 3.465 N Clec12a n/a
8 TRCN0000179408 GATCGCACACAATATCCACTA pLKO.1 697 CDS 100% 4.050 2.835 N Clec12a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.