Transcript: Mouse XM_011241354.1

PREDICTED: Mus musculus anoctamin 2 (Ano2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ano2 (243634)
Length:
3952
CDS:
337..3333

Additional Resources:

NCBI RefSeq record:
XM_011241354.1
NBCI Gene record:
Ano2 (243634)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135807 CAACAACACGATGGGTATTAA pLKO.1 1215 CDS 100% 15.000 21.000 N ANO2 n/a
2 TRCN0000138764 GCCAACAACACGATGGGTATT pLKO.1 1213 CDS 100% 10.800 15.120 N ANO2 n/a
3 TRCN0000127012 CGATGGGTATTAACTCTCTAA pLKO.1 1223 CDS 100% 4.950 6.930 N Ano2 n/a
4 TRCN0000127011 CCCGAAGCTAAAGAAACTCTT pLKO.1 2418 CDS 100% 4.950 3.960 N Ano2 n/a
5 TRCN0000127013 GCCAGTCATCTGTTTGACAAT pLKO.1 1627 CDS 100% 4.950 3.960 N Ano2 n/a
6 TRCN0000127009 CCATCATCTTAGGTGAAAGAA pLKO.1 3632 3UTR 100% 5.625 3.938 N Ano2 n/a
7 TRCN0000127010 GCCTCCATCTTGTTTATGATT pLKO.1 1936 CDS 100% 5.625 3.938 N Ano2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.