Transcript: Mouse XM_011241688.2

PREDICTED: Mus musculus myosin VIIA (Myo7a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myo7a (17921)
Length:
7348
CDS:
23..6775

Additional Resources:

NCBI RefSeq record:
XM_011241688.2
NBCI Gene record:
Myo7a (17921)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110509 GCCCTTCTTTGTGCGTTGTAT pLKO.1 2014 CDS 100% 5.625 7.875 N Myo7a n/a
2 TRCN0000324295 GCCCTTCTTTGTGCGTTGTAT pLKO_005 2014 CDS 100% 5.625 7.875 N Myo7a n/a
3 TRCN0000110506 CCCTGCTAACAGATTCAGCAA pLKO.1 3939 CDS 100% 2.640 3.696 N Myo7a n/a
4 TRCN0000324294 CCCTGCTAACAGATTCAGCAA pLKO_005 3939 CDS 100% 2.640 3.696 N Myo7a n/a
5 TRCN0000110508 GCCCACAAGAAGGGAATTTAT pLKO.1 4439 CDS 100% 15.000 10.500 N Myo7a n/a
6 TRCN0000324296 GCCCACAAGAAGGGAATTTAT pLKO_005 4439 CDS 100% 15.000 10.500 N Myo7a n/a
7 TRCN0000110505 CCTGGTGTAAGAGTCTGTGTT pLKO.1 6935 3UTR 100% 4.950 3.465 N Myo7a n/a
8 TRCN0000324293 CCTGGTGTAAGAGTCTGTGTT pLKO_005 6935 3UTR 100% 4.950 3.465 N Myo7a n/a
9 TRCN0000110507 CGCTACAGCTTTGTGGAGTTT pLKO.1 2150 CDS 100% 4.950 2.970 N Myo7a n/a
10 TRCN0000353850 CGCTACAGCTTTGTGGAGTTT pLKO_005 2150 CDS 100% 4.950 2.970 N Myo7a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.