Transcript: Mouse XM_011241737.1

PREDICTED: Mus musculus monoacylglycerol O-acyltransferase 2 (Mogat2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mogat2 (233549)
Length:
1783
CDS:
16..1062

Additional Resources:

NCBI RefSeq record:
XM_011241737.1
NBCI Gene record:
Mogat2 (233549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340658 GGGTCCTCTGAGCTATGATAC pLKO_005 1516 3UTR 100% 10.800 15.120 N Mogat2 n/a
2 TRCN0000018843 GCACGGGCTTTACCTCGCTTT pLKO.1 431 CDS 100% 1.350 1.890 N Mogat2 n/a
3 TRCN0000340657 GCACGGGCTTTACCTCGCTTT pLKO_005 431 CDS 100% 1.350 1.890 N Mogat2 n/a
4 TRCN0000018443 GCCTCCTATTCACAAGGTTCT pLKO.1 176 CDS 100% 4.050 3.240 N Mogat2 n/a
5 TRCN0000352526 GCCTCCTATTCACAAGGTTCT pLKO_005 176 CDS 100% 4.050 3.240 N Mogat2 n/a
6 TRCN0000018440 CGATCACATTCTGTCCAGGAA pLKO.1 561 CDS 100% 2.640 2.112 N Mogat2 n/a
7 TRCN0000018442 TGGAAGTACATGAAGGATTAT pLKO.1 295 CDS 100% 13.200 9.240 N Mogat2 n/a
8 TRCN0000340730 TGGAAGTACATGAAGGATTAT pLKO_005 295 CDS 100% 13.200 9.240 N Mogat2 n/a
9 TRCN0000018441 CCTGTTCAACCAGGTTGAGAA pLKO.1 747 CDS 100% 4.950 3.465 N Mogat2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.