Transcript: Mouse XM_011241807.1

PREDICTED: Mus musculus olfactory receptor 301 (Olfr301), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Olfr301 (257958)
Length:
1209
CDS:
139..1209

Additional Resources:

NCBI RefSeq record:
XM_011241807.1
NBCI Gene record:
Olfr301 (257958)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241807.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203189 GATAGGGAATCTTATCATCAT pLKO.1 384 CDS 100% 4.950 3.465 N Olfr301 n/a
2 TRCN0000188526 CCACTGGTTCTGTGTTCAGAT pLKO.1 678 CDS 100% 4.950 2.970 N Olfr301 n/a
3 TRCN0000197313 GCTTCCCTACTTAGCTCACTT pLKO.1 706 CDS 100% 4.950 2.970 N Olfr301 n/a
4 TRCN0000204206 GCTTTCTTGCTCTGATACCTT pLKO.1 825 CDS 100% 3.000 1.800 N Olfr301 n/a
5 TRCN0000203497 CCTCAGTTCTTCTGTGATATT pLKO.1 790 CDS 100% 13.200 6.600 Y Olfr301 n/a
6 TRCN0000204577 CCGAGTTCATGCTGGAAGATT pLKO.1 296 CDS 100% 5.625 2.813 Y Olfr293 n/a
7 TRCN0000187872 GTCCCTCAGTTCTTCTGTGAT pLKO.1 787 CDS 100% 4.950 2.475 Y Olfr292 n/a
8 TRCN0000187433 GCTTGTATCAACTCTCTCACT pLKO.1 508 CDS 100% 2.640 1.320 Y Olfr293 n/a
9 TRCN0000060371 CCATGTACTTCTTCCTCAGAA pLKO.1 440 CDS 100% 4.950 2.475 Y OR10A2 n/a
10 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 439 CDS 100% 2.640 1.320 Y Olfr317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241807.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.