Transcript: Mouse XM_011241817.3

PREDICTED: Mus musculus endoplasmic reticulum (ER) to nucleus signalling 2 (Ern2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ern2 (26918)
Length:
2994
CDS:
88..2847

Additional Resources:

NCBI RefSeq record:
XM_011241817.3
NBCI Gene record:
Ern2 (26918)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241817.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360382 TTCTCCGCAGGCTGCGTATTT pLKO_005 2167 CDS 100% 13.200 18.480 N Ern2 n/a
2 TRCN0000360383 GTGCCTGTGACAGGGATTTAC pLKO_005 763 CDS 100% 13.200 10.560 N Ern2 n/a
3 TRCN0000012621 CGCTCATACAAAGGGACATCA pLKO.1 2563 CDS 100% 4.950 3.960 N Ern2 n/a
4 TRCN0000360381 GAATGGCTCACCCGGGAAATA pLKO_005 654 CDS 100% 13.200 9.240 N Ern2 n/a
5 TRCN0000012620 GCTGGGTTCTATGTCTCTAAA pLKO.1 967 CDS 100% 13.200 9.240 N Ern2 n/a
6 TRCN0000012618 GCCTCTCTACTCCTCAACTTT pLKO.1 536 CDS 100% 5.625 3.938 N Ern2 n/a
7 TRCN0000012622 CCAGTGGCTACTCATTGGATA pLKO.1 1149 CDS 100% 4.950 3.465 N Ern2 n/a
8 TRCN0000012619 CCATCTACATTCCTTACACAT pLKO.1 1929 CDS 100% 4.950 3.465 N Ern2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241817.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.