Transcript: Mouse XM_011241835.2

PREDICTED: Mus musculus tripartite motif-containing 66 (Trim66), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trim66 (330627)
Length:
9162
CDS:
460..4188

Additional Resources:

NCBI RefSeq record:
XM_011241835.2
NBCI Gene record:
Trim66 (330627)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126820 CCAGGCATTATTACCAGATTA pLKO.1 3758 CDS 100% 13.200 9.240 N Trim66 n/a
2 TRCN0000126821 GCTGCCTCTTATGGGAGTTTA pLKO.1 1294 CDS 100% 13.200 9.240 N Trim66 n/a
3 TRCN0000126819 CGCTGCTTCATTGAGCCATAT pLKO.1 8966 3UTR 100% 10.800 7.560 N Trim66 n/a
4 TRCN0000126823 CCAGCCTGATGAGTGTTTCAA pLKO.1 2486 CDS 100% 5.625 3.938 N Trim66 n/a
5 TRCN0000126822 GCACATAAGAAATCCAGCCTA pLKO.1 817 CDS 100% 2.640 1.848 N Trim66 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.