Transcript: Mouse XM_011242057.2

PREDICTED: Mus musculus microcephaly, primary autosomal recessive 1 (Mcph1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mcph1 (244329)
Length:
7193
CDS:
329..2965

Additional Resources:

NCBI RefSeq record:
XM_011242057.2
NBCI Gene record:
Mcph1 (244329)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242057.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201304 GCAGTGAATACCGATGAACAT pLKO.1 623 CDS 100% 4.950 6.930 N Mcph1 n/a
2 TRCN0000189764 GCCAACGAGAACATTGGTCAT pLKO.1 2407 CDS 100% 4.050 5.670 N Mcph1 n/a
3 TRCN0000242051 AGATACTTGTTCCCAATTATA pLKO_005 3135 3UTR 100% 15.000 10.500 N Mcph1 n/a
4 TRCN0000242052 CCACTCATCTTTCGGTGATTC pLKO_005 1096 CDS 100% 10.800 7.560 N Mcph1 n/a
5 TRCN0000242050 CTCCTACGATGTCCATCATAG pLKO_005 1386 CDS 100% 10.800 7.560 N Mcph1 n/a
6 TRCN0000242053 GCACTTGTTGATGAGTCTTTG pLKO_005 596 CDS 100% 10.800 7.560 N Mcph1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242057.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.