Transcript: Mouse XM_011242342.1

PREDICTED: Mus musculus plasmalemma vesicle associated protein (Plvap), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plvap (84094)
Length:
2115
CDS:
89..1447

Additional Resources:

NCBI RefSeq record:
XM_011242342.1
NBCI Gene record:
Plvap (84094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247028 TGATCACCTACATAAACTATA pLKO_005 453 CDS 100% 13.200 18.480 N Plvap n/a
2 TRCN0000247027 TGGTACTACCTGCGCTATTTC pLKO_005 149 CDS 100% 13.200 18.480 N Plvap n/a
3 TRCN0000247025 TGGTCCTCTTCATGATCTATG pLKO_005 213 CDS 100% 10.800 15.120 N Plvap n/a
4 TRCN0000247026 AGGGTTTCCAGATCCTATTTG pLKO_005 1865 3UTR 100% 13.200 9.240 N Plvap n/a
5 TRCN0000215573 GATCACCTACATAAACTATAA pLKO.1 454 CDS 100% 13.200 9.240 N Plvap n/a
6 TRCN0000194379 CTAGGGTTTCCAGATCCTATT pLKO.1 1863 3UTR 100% 10.800 7.560 N Plvap n/a
7 TRCN0000247029 TCCTCTTCGTGTCGCTCATTC pLKO_005 171 CDS 100% 10.800 7.560 N Plvap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.