Transcript: Mouse XM_011242427.2

PREDICTED: Mus musculus roundabout guidance receptor 3 (Robo3), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Robo3 (19649)
Length:
3047
CDS:
110..2782

Additional Resources:

NCBI RefSeq record:
XM_011242427.2
NBCI Gene record:
Robo3 (19649)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100019 CCAGATGATAGATACTACAAT pLKO.1 1538 CDS 100% 5.625 7.875 N Robo3 n/a
2 TRCN0000100016 CCTGGGTAATGAAAGCCGATT pLKO.1 1003 CDS 100% 4.050 3.240 N Robo3 n/a
3 TRCN0000100018 GCCTGTACAAATGCCATCTTT pLKO.1 1789 CDS 100% 5.625 3.375 N Robo3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12461 pDONR223 100% 14.5% 14.4% None (many diffs) n/a
2 ccsbBroad304_12461 pLX_304 0% 14.5% 14.4% V5 (many diffs) n/a
Download CSV