Transcript: Mouse XM_011242627.3

PREDICTED: Mus musculus non-SMC condensin II complex, subunit D3 (Ncapd3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ncapd3 (78658)
Length:
4371
CDS:
276..2654

Additional Resources:

NCBI RefSeq record:
XM_011242627.3
NBCI Gene record:
Ncapd3 (78658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242627.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414981 TCCATCAGTGACGTCACATTT pLKO_005 2415 CDS 100% 13.200 10.560 N Ncapd3 n/a
2 TRCN0000215444 GACTTTCTCACAATAACATTA pLKO.1 2874 3UTR 100% 13.200 9.240 N Ncapd3 n/a
3 TRCN0000432911 TATACTGTGATACTCTATTTG pLKO_005 2902 3UTR 100% 13.200 9.240 N Ncapd3 n/a
4 TRCN0000182614 GCTGTGTGTCATTGGGCATAT pLKO.1 392 CDS 100% 10.800 7.560 N Ncapd3 n/a
5 TRCN0000446710 GTCTCCACAGTGGAACGTAAA pLKO_005 2555 CDS 100% 10.800 7.560 N Ncapd3 n/a
6 TRCN0000182156 CCAACCTCTTACAGGAGGAAT pLKO.1 1126 CDS 100% 4.950 3.465 N Ncapd3 n/a
7 TRCN0000199006 GCTCTCAGATACCTTTGACAT pLKO.1 1541 CDS 100% 4.950 3.465 N Ncapd3 n/a
8 TRCN0000197707 GCTTTCTTCTGTATAACTCAA pLKO.1 2986 3UTR 100% 4.950 3.465 N Ncapd3 n/a
9 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 3984 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242627.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.