Transcript: Mouse XM_011242631.2

PREDICTED: Mus musculus melanoma cell adhesion molecule (Mcam), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mcam (84004)
Length:
3145
CDS:
627..2231

Additional Resources:

NCBI RefSeq record:
XM_011242631.2
NBCI Gene record:
Mcam (84004)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242631.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113082 CCGACTCGTAAGAGTGAATTT pLKO.1 2094 CDS 100% 13.200 18.480 N Mcam n/a
2 TRCN0000376813 CGACTCGTAAGAGTGAATTTG pLKO_005 2095 CDS 100% 13.200 18.480 N Mcam n/a
3 TRCN0000113084 ACCGAGTTCATATCCAGTCAT pLKO.1 847 CDS 100% 4.950 6.930 N Mcam n/a
4 TRCN0000275794 AGTTGAAGTTAAGTCAGATAA pLKO_005 2117 CDS 100% 13.200 10.560 N MCAM n/a
5 TRCN0000375735 TACATCGATCTGAGGCATTAG pLKO_005 2211 CDS 100% 10.800 8.640 N Mcam n/a
6 TRCN0000113081 CGCCTAGTTAAGGAAGACAAA pLKO.1 921 CDS 100% 4.950 3.960 N Mcam n/a
7 TRCN0000366859 CAGCGGGAACCTGGTGAATAT pLKO_005 534 5UTR 100% 13.200 9.240 N Mcam n/a
8 TRCN0000375683 CCTCCTCTGTGTCCAGTAAAT pLKO_005 2421 3UTR 100% 13.200 9.240 N Mcam n/a
9 TRCN0000366798 TACTAATTCAGGGTCTCATTT pLKO_005 2676 3UTR 100% 13.200 9.240 N Mcam n/a
10 TRCN0000113080 GCTACTAATTCAGGGTCTCAT pLKO.1 2674 3UTR 100% 4.950 3.465 N Mcam n/a
11 TRCN0000113083 GCAGAAAGTAACCAGGACCTT pLKO.1 1389 CDS 100% 2.640 1.848 N Mcam n/a
12 TRCN0000375737 TGGAGCTGCTGGTGAACTATG pLKO_005 1297 CDS 100% 10.800 6.480 N Mcam n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242631.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.