Transcript: Mouse XM_011242672.2

PREDICTED: Mus musculus neural precursor cell expressed, developmentally down-regulated 4 (Nedd4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nedd4 (17999)
Length:
3777
CDS:
75..2204

Additional Resources:

NCBI RefSeq record:
XM_011242672.2
NBCI Gene record:
Nedd4 (17999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361314 ATATTCTGCTACGGATAATTA pLKO_005 1328 CDS 100% 15.000 21.000 N Nedd4 n/a
2 TRCN0000092436 CCTACTACGTAAACCATGAAT pLKO.1 334 CDS 100% 5.625 7.875 N Nedd4 n/a
3 TRCN0000092434 GCGCAAACATTCTGGAGGATT pLKO.1 1147 CDS 100% 4.950 6.930 N Nedd4 n/a
4 TRCN0000092433 GCGACATACTTAGTACCACAT pLKO.1 2603 3UTR 100% 4.050 5.670 N Nedd4 n/a
5 TRCN0000367980 GGATTCTTACCGGAGGATTAT pLKO_005 1163 CDS 100% 13.200 10.560 N Nedd4 n/a
6 TRCN0000361313 TTGATGGCGTTGATTAGATTA pLKO_005 2188 CDS 100% 13.200 10.560 N Nedd4 n/a
7 TRCN0000092435 GCTCAAGAAGCAGACTGACAT pLKO.1 1097 CDS 100% 4.950 3.465 N Nedd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.