Transcript: Mouse XM_011242737.2

PREDICTED: Mus musculus solute carrier family 17 (anion/sugar transporter), member 5 (Slc17a5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc17a5 (235504)
Length:
3250
CDS:
631..1575

Additional Resources:

NCBI RefSeq record:
XM_011242737.2
NBCI Gene record:
Slc17a5 (235504)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079515 CGCTGACTATTTAAGGGTCAA pLKO.1 1131 CDS 100% 4.050 5.670 N Slc17a5 n/a
2 TRCN0000079516 CTACTATATGAACTGGACTTA pLKO.1 750 CDS 100% 4.950 3.960 N Slc17a5 n/a
3 TRCN0000079517 GCTACTATATGAACTGGACTT pLKO.1 749 CDS 100% 4.050 2.835 N Slc17a5 n/a
4 TRCN0000079514 GCTCGGTACAACTTAGCGATT pLKO.1 164 5UTR 100% 4.050 2.835 N Slc17a5 n/a
5 TRCN0000079513 GCATAGGAAATGAAGCTGAAA pLKO.1 2071 3UTR 100% 4.950 2.970 N Slc17a5 n/a
6 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 1790 3UTR 100% 2.640 1.320 Y BC028528 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2096 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.