Transcript: Mouse XM_011242760.2

PREDICTED: Mus musculus enhancer of mRNA decapping 3 (Edc3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Edc3 (353190)
Length:
2883
CDS:
125..1651

Additional Resources:

NCBI RefSeq record:
XM_011242760.2
NBCI Gene record:
Edc3 (353190)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249227 CCTTTCGGGCAGGTGATATTA pLKO_005 282 CDS 100% 15.000 12.000 N Edc3 n/a
2 TRCN0000249228 TTTGAGGAGATCGACACTTAC pLKO_005 779 CDS 100% 10.800 8.640 N Edc3 n/a
3 TRCN0000196021 GCCTCCATTAAACTGGAGCTT pLKO.1 1895 3UTR 100% 0.264 0.211 N Edc3 n/a
4 TRCN0000216697 CAAGATGCTGGAGTCTATTAC pLKO.1 1240 CDS 100% 13.200 9.240 N Edc3 n/a
5 TRCN0000249226 TCAAGATGCTGGAGTCTATTA pLKO_005 1239 CDS 100% 13.200 9.240 N Edc3 n/a
6 TRCN0000249229 TTGGTGCTTCTACCATCATTT pLKO_005 2388 3UTR 100% 13.200 9.240 N Edc3 n/a
7 TRCN0000249225 CGAGTGCTTTGGAGACGATAT pLKO_005 691 CDS 100% 10.800 7.560 N Edc3 n/a
8 TRCN0000180933 GAAGTTGAACAGGGCATTGAT pLKO.1 1466 CDS 100% 5.625 3.938 N Edc3 n/a
9 TRCN0000180604 GAGACCTTCATCAGACAGAAT pLKO.1 354 CDS 100% 4.950 3.465 N Edc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04178 pDONR223 100% 89.6% 95.6% None (many diffs) n/a
2 ccsbBroad304_04178 pLX_304 0% 89.6% 95.6% V5 (many diffs) n/a
Download CSV