Transcript: Mouse XM_011242951.1

PREDICTED: Mus musculus solute carrier family 25, member 38 (Slc25a38), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc25a38 (208638)
Length:
1683
CDS:
575..1105

Additional Resources:

NCBI RefSeq record:
XM_011242951.1
NBCI Gene record:
Slc25a38 (208638)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249710 GCGCCTTAGAATATTGGTAAT pLKO_005 1391 3UTR 100% 10.800 15.120 N Slc25a38 n/a
2 TRCN0000249708 CGCTATGAGAGTGGGACTTAC pLKO_005 632 CDS 100% 10.800 8.640 N Slc25a38 n/a
3 TRCN0000249709 ATTTCTCCTGTGGGATATTTG pLKO_005 849 CDS 100% 13.200 9.240 N Slc25a38 n/a
4 TRCN0000175107 GTATTCTTCGAAGCAGTATTT pLKO.1 508 5UTR 100% 13.200 9.240 N Slc25a38 n/a
5 TRCN0000249711 TCTACTTTGGCACCCTGTATT pLKO_005 492 5UTR 100% 13.200 9.240 N Slc25a38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.