Transcript: Mouse XM_011243155.2

PREDICTED: Mus musculus nuclear receptor coactivator 7 (Ncoa7), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ncoa7 (211329)
Length:
5316
CDS:
595..3276

Additional Resources:

NCBI RefSeq record:
XM_011243155.2
NBCI Gene record:
Ncoa7 (211329)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243155.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201060 CCGATCCCTTAGTGATTGAAA pLKO.1 1364 CDS 100% 5.625 7.875 N Ncoa7 n/a
2 TRCN0000217804 CATCAGGCCGATCACTATATT pLKO.1 4887 3UTR 100% 15.000 12.000 N Ncoa7 n/a
3 TRCN0000190323 CGATTTGGTCTGTGGCTAGAT pLKO.1 3251 CDS 100% 4.950 3.960 N Ncoa7 n/a
4 TRCN0000241626 AGTAGTCTATCGCGAATTATT pLKO_005 4743 3UTR 100% 15.000 10.500 N Ncoa7 n/a
5 TRCN0000241624 GACATGGATAACCAGATATTT pLKO_005 3136 CDS 100% 15.000 10.500 N Ncoa7 n/a
6 TRCN0000241625 AGCTGAACATGATCGACAATT pLKO_005 2813 CDS 100% 13.200 9.240 N Ncoa7 n/a
7 TRCN0000191030 CAACTCTGAATTGTGGAAATT pLKO.1 1701 CDS 100% 13.200 9.240 N Ncoa7 n/a
8 TRCN0000241622 CAAGTTCAGTGACCACTATTA pLKO_005 3180 CDS 100% 13.200 9.240 N Ncoa7 n/a
9 TRCN0000365163 CAAGTTCAGTGACCACTATTA pLKO_005 3180 CDS 100% 13.200 9.240 N NCOA7 n/a
10 TRCN0000217816 CTACACCTTTAGTCCGAATTT pLKO.1 3222 CDS 100% 13.200 9.240 N Ncoa7 n/a
11 TRCN0000241623 ACCCATCGAGAGGGTCTTATC pLKO_005 1206 CDS 100% 10.800 7.560 N Ncoa7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243155.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.