Transcript: Mouse XM_011243168.2

PREDICTED: Mus musculus utrophin (Utrn), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Utrn (22288)
Length:
12162
CDS:
95..10303

Additional Resources:

NCBI RefSeq record:
XM_011243168.2
NBCI Gene record:
Utrn (22288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243168.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313788 TGTCCGGCGTCTGGCTATATT pLKO_005 1717 CDS 100% 15.000 21.000 N Utrn n/a
2 TRCN0000054284 CCTGACAAGAAATCCATAATT pLKO.1 722 CDS 100% 15.000 10.500 N UTRN n/a
3 TRCN0000313857 CTATCCAGCCAGCCAACATTT pLKO_005 10308 3UTR 100% 13.200 9.240 N Utrn n/a
4 TRCN0000108847 CCACTCAAGAATAGAGCAATA pLKO.1 9574 CDS 100% 10.800 7.560 N Utrn n/a
5 TRCN0000317441 CCACTCAAGAATAGAGCAATA pLKO_005 9574 CDS 100% 10.800 7.560 N Utrn n/a
6 TRCN0000108846 GCTGGTATTGATCGACCAAAT pLKO.1 6727 CDS 100% 10.800 7.560 N Utrn n/a
7 TRCN0000317373 GCTGGTATTGATCGACCAAAT pLKO_005 6727 CDS 100% 10.800 7.560 N Utrn n/a
8 TRCN0000108849 CCAGCGAGTAAACAGGAAGAA pLKO.1 5054 CDS 100% 4.950 3.465 N Utrn n/a
9 TRCN0000317440 CCAGCGAGTAAACAGGAAGAA pLKO_005 5054 CDS 100% 4.950 3.465 N Utrn n/a
10 TRCN0000054285 CCCTATTACATCAACCATCAA pLKO.1 8486 CDS 100% 4.950 3.465 N UTRN n/a
11 TRCN0000054283 GCCCAGATTGAGGAAGTTCTA pLKO.1 5429 CDS 100% 4.950 3.465 N UTRN n/a
12 TRCN0000292035 GCCCAGATTGAGGAAGTTCTA pLKO_005 5429 CDS 100% 4.950 3.465 N UTRN n/a
13 TRCN0000108848 CCCACTCAAGAATAGAGCAAT pLKO.1 9573 CDS 100% 4.950 2.970 N Utrn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243168.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.