Transcript: Mouse XM_011243269.2

PREDICTED: Mus musculus methyl-CpG binding domain protein 6 (Mbd6), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mbd6 (110962)
Length:
4142
CDS:
248..3265

Additional Resources:

NCBI RefSeq record:
XM_011243269.2
NBCI Gene record:
Mbd6 (110962)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178563 CCGAAACACATAGCCTCATTT pLKO.1 3791 3UTR 100% 13.200 18.480 N Mbd6 n/a
2 TRCN0000257307 GGTCTGGAGTGTCCACTTAAT pLKO_005 440 CDS 100% 13.200 18.480 N MBD6 n/a
3 TRCN0000336147 GGTCTGGAGTGTCCACTTAAT pLKO_005 440 CDS 100% 13.200 18.480 N Mbd6 n/a
4 TRCN0000200459 GACCGAAACACATAGCCTCAT pLKO.1 3789 3UTR 100% 4.050 5.670 N Mbd6 n/a
5 TRCN0000038788 CCACAGTTTATTTGGTGTGCT pLKO.1 1924 CDS 100% 2.640 2.112 N MBD6 n/a
6 TRCN0000336097 AGAAGGTGCTGTGTACTATAT pLKO_005 343 CDS 100% 13.200 9.240 N Mbd6 n/a
7 TRCN0000216116 CATTCCTTAGCCACAGTTTAT pLKO.1 1914 CDS 100% 13.200 9.240 N Mbd6 n/a
8 TRCN0000336098 GTGAAAGGTACAGAGCAATAA pLKO_005 3677 3UTR 100% 13.200 9.240 N Mbd6 n/a
9 TRCN0000038787 TGGTGGCTTCAATGGACAAAT pLKO.1 2941 CDS 100% 13.200 9.240 N MBD6 n/a
10 TRCN0000336155 ACCCATTCTGAGGACCTTAAG pLKO_005 3053 CDS 100% 10.800 7.560 N Mbd6 n/a
11 TRCN0000336096 CCTCCTACAACTCCACTTAAC pLKO_005 707 CDS 100% 10.800 7.560 N Mbd6 n/a
12 TRCN0000198173 CAGTGAAAGGTACAGAGCAAT pLKO.1 3675 3UTR 100% 4.950 3.465 N Mbd6 n/a
13 TRCN0000178114 GCTCAGTTTACAAACCTGTGA pLKO.1 3627 3UTR 100% 2.640 1.848 N Mbd6 n/a
14 TRCN0000182176 CCTCATTTCAAAGCGTAGCCA pLKO.1 3804 3UTR 100% 0.750 0.525 N Mbd6 n/a
15 TRCN0000197688 GTACAGAGCAATAAGCATCAT pLKO.1 3684 3UTR 100% 4.950 2.970 N Mbd6 n/a
16 TRCN0000038786 CCTCCTACAACTCCACTTAAT pLKO.1 707 CDS 100% 13.200 9.240 N MBD6 n/a
17 TRCN0000229915 CCTCCTACAACTCCACTTAAT pLKO_005 707 CDS 100% 13.200 9.240 N MBD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.