Transcript: Mouse XM_011243391.2

PREDICTED: Mus musculus DOT1-like, histone H3 methyltransferase (S. cerevisiae) (Dot1l), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dot1l (208266)
Length:
8647
CDS:
315..4952

Additional Resources:

NCBI RefSeq record:
XM_011243391.2
NBCI Gene record:
Dot1l (208266)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243391.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020209 CGCCAACACGAGTGTTATATT pLKO.1 1010 CDS 100% 15.000 21.000 N DOT1L n/a
2 TRCN0000236345 TCGCCAACACGAGTGTTATAT pLKO_005 1009 CDS 100% 15.000 21.000 N DOT1L n/a
3 TRCN0000125102 CGGCAGAATCGTATCCTCAAA pLKO.1 1103 CDS 100% 4.950 6.930 N Dot1l n/a
4 TRCN0000125099 GTCCAGTTTGTACTGTCAATA pLKO.1 6826 3UTR 100% 13.200 9.240 N Dot1l n/a
5 TRCN0000125101 CCTCGGTTTACACAGCTTCAA pLKO.1 4292 CDS 100% 4.950 3.465 N Dot1l n/a
6 TRCN0000125100 GCTGACCTACAATGACCTGAT pLKO.1 1982 CDS 100% 4.050 2.835 N Dot1l n/a
7 TRCN0000125103 GCTTAACAACTACGAGCCCTT pLKO.1 686 CDS 100% 2.160 1.512 N Dot1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243391.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.