Transcript: Mouse XM_011243445.1

PREDICTED: Mus musculus growth arrest-specific 2 like 3 (Gas2l3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gas2l3 (237436)
Length:
7418
CDS:
986..3037

Additional Resources:

NCBI RefSeq record:
XM_011243445.1
NBCI Gene record:
Gas2l3 (237436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087907 CTAATGAAAGCGTGCCAGATT pLKO.1 1890 CDS 100% 4.950 3.960 N Gas2l3 n/a
2 TRCN0000087905 CCTCTTTGAGTCGGAAGGTTT pLKO.1 1414 CDS 100% 4.950 3.465 N Gas2l3 n/a
3 TRCN0000087906 CGAAAGGTAAGAATACAGTTT pLKO.1 2685 CDS 100% 4.950 3.465 N Gas2l3 n/a
4 TRCN0000087904 GCTCGATAATGGAGTGCTGTT pLKO.1 1213 CDS 100% 4.050 2.835 N Gas2l3 n/a
5 TRCN0000087903 GCCTCCAGAAATGAACCCTTT pLKO.1 1930 CDS 100% 4.050 2.430 N Gas2l3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4285 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.