Transcript: Mouse XM_011243451.1

PREDICTED: Mus musculus transmembrane and tetratricopeptide repeat containing 3 (Tmtc3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmtc3 (237500)
Length:
1816
CDS:
199..1692

Additional Resources:

NCBI RefSeq record:
XM_011243451.1
NBCI Gene record:
Tmtc3 (237500)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177816 CCCGATTGTATTAACCGTGTT pLKO.1 729 CDS 100% 4.050 2.835 N Tmtc3 n/a
2 TRCN0000178062 GCGCTTTGTTTAATGGCGTTA pLKO.1 1264 CDS 100% 4.050 2.835 N Tmtc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05107 pDONR223 100% 45.3% 48.3% None (many diffs) n/a
2 ccsbBroad304_05107 pLX_304 0% 45.3% 48.3% V5 (many diffs) n/a
Download CSV