Transcript: Mouse XM_011243513.2

PREDICTED: Mus musculus carbohydrate (chondroitin 6/keratan) sulfotransferase 3 (Chst3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chst3 (53374)
Length:
6781
CDS:
2375..3811

Additional Resources:

NCBI RefSeq record:
XM_011243513.2
NBCI Gene record:
Chst3 (53374)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243513.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103204 GAGGTTGGATCTACGAGTCAT pLKO.1 3244 CDS 100% 4.950 6.930 N Chst3 n/a
2 TRCN0000103201 GCCTAAAGATTCGAGGCAGAT pLKO.1 2442 CDS 100% 4.050 5.670 N Chst3 n/a
3 TRCN0000103202 CCCTTCGTCAAGAAGGTCTTT pLKO.1 3080 CDS 100% 0.495 0.693 N Chst3 n/a
4 TRCN0000103200 CCCAGCATTCAGGAAATCAAA pLKO.1 5165 3UTR 100% 5.625 3.938 N Chst3 n/a
5 TRCN0000103203 GATGTCTACTCCACTCAGAAA pLKO.1 3608 CDS 100% 4.950 3.465 N Chst3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4736 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243513.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.