Transcript: Mouse XM_011243522.1

PREDICTED: Mus musculus solute carrier family 5 (neutral amino acid transporters, system A), member 4b (Slc5a4b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc5a4b (64454)
Length:
1621
CDS:
16..1551

Additional Resources:

NCBI RefSeq record:
XM_011243522.1
NBCI Gene record:
Slc5a4b (64454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079633 GCCGGGACTGATATTTGGAAT pLKO.1 396 CDS 100% 4.950 6.930 N Slc5a4b n/a
2 TRCN0000079637 CCAGTAACTGTCCCAAGATTA pLKO.1 1109 CDS 100% 13.200 9.240 N Slc5a4b n/a
3 TRCN0000079634 CGGATAGACTTGGATGCAGAA pLKO.1 1276 CDS 100% 4.050 2.835 N Slc5a4b n/a
4 TRCN0000079636 GCAGACTTTCATCATGCTGCT pLKO.1 186 CDS 100% 2.160 1.512 N Slc5a4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.