Transcript: Mouse XM_011243748.2

PREDICTED: Mus musculus vaccinia related kinase 2 (Vrk2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vrk2 (69922)
Length:
1442
CDS:
238..1395

Additional Resources:

NCBI RefSeq record:
XM_011243748.2
NBCI Gene record:
Vrk2 (69922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276682 ATAATGGGACAATAGAGTTTA pLKO_005 512 CDS 100% 13.200 18.480 N Vrk2 n/a
2 TRCN0000023760 GCCGCAAATCTACTGTTGGAT pLKO.1 388 CDS 100% 3.000 4.200 N Vrk2 n/a
3 TRCN0000276683 GCCGCAAATCTACTGTTGGAT pLKO_005 388 CDS 100% 3.000 4.200 N Vrk2 n/a
4 TRCN0000361783 AGTATGTTCATGGTGATATAA pLKO_005 365 CDS 100% 15.000 12.000 N Vrk2 n/a
5 TRCN0000361784 GTACTTGATGTATGTTCATAA pLKO_005 753 CDS 100% 13.200 9.240 N Vrk2 n/a
6 TRCN0000276685 GTCCCAATGGGAACCACAAAC pLKO_005 464 CDS 100% 10.800 7.560 N Vrk2 n/a
7 TRCN0000023759 CCAGCTAAGTTCCCAAAGAAA pLKO.1 949 CDS 100% 5.625 3.938 N Vrk2 n/a
8 TRCN0000276621 CCAGCTAAGTTCCCAAAGAAA pLKO_005 949 CDS 100% 5.625 3.938 N Vrk2 n/a
9 TRCN0000023761 CCAAACAAAGATGCAAGACAT pLKO.1 37 5UTR 100% 4.950 3.465 N Vrk2 n/a
10 TRCN0000023762 CCGGGTTTATCTTGCAGACTA pLKO.1 423 CDS 100% 4.950 3.465 N Vrk2 n/a
11 TRCN0000276686 CCGGGTTTATCTTGCAGACTA pLKO_005 423 CDS 100% 4.950 3.465 N Vrk2 n/a
12 TRCN0000361785 CTGGATGTACTGGAATATATA pLKO_005 334 CDS 100% 15.000 9.000 N Vrk2 n/a
13 TRCN0000010208 ACCACAAACAGTATCAGGAAA pLKO.1 476 CDS 100% 4.950 3.465 N VRK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.