Transcript: Mouse XM_011243837.2

PREDICTED: Mus musculus myelin transcription factor 1-like (Myt1l), transcript variant X29, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myt1l (17933)
Length:
5043
CDS:
672..3449

Additional Resources:

NCBI RefSeq record:
XM_011243837.2
NBCI Gene record:
Myt1l (17933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429884 ATGAGTTGTACTCGAATAATG pLKO_005 1197 CDS 100% 13.200 18.480 N Myt1l n/a
2 TRCN0000012112 CTCGGATATGATGAACCTTAT pLKO.1 1802 CDS 100% 10.800 15.120 N Myt1l n/a
3 TRCN0000012110 CGACAACCATACTTATGGCAA pLKO.1 2627 CDS 100% 2.640 2.112 N Myt1l n/a
4 TRCN0000416921 GTCCACACGTTGTCGTGAAAT pLKO_005 2891 CDS 100% 13.200 9.240 N Myt1l n/a
5 TRCN0000426489 ATGATGAGTATGATAACTATG pLKO_005 1246 CDS 100% 10.800 7.560 N Myt1l n/a
6 TRCN0000012111 GCAAATATGCACGACACAGAA pLKO.1 802 CDS 100% 4.950 3.465 N Myt1l n/a
7 TRCN0000347067 AGAAGATGATGATGATGAATA pLKO_005 1091 CDS 100% 13.200 6.600 Y Hmgb1-ps7 n/a
8 TRCN0000063714 GAAGAAGATGATGATGATGAT pLKO.1 1089 CDS 100% 4.950 2.475 Y SET n/a
9 TRCN0000288612 GAAGAAGATGATGATGATGAT pLKO_005 1089 CDS 100% 4.950 2.475 Y SET n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.