Transcript: Mouse XM_011243868.2

PREDICTED: Mus musculus component of oligomeric golgi complex 5 (Cog5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cog5 (238123)
Length:
5783
CDS:
23..2512

Additional Resources:

NCBI RefSeq record:
XM_011243868.2
NBCI Gene record:
Cog5 (238123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07615 pDONR223 100% 80.6% 81.9% None (many diffs) n/a
2 ccsbBroad304_07615 pLX_304 0% 80.6% 81.9% V5 (many diffs) n/a
3 TRCN0000472725 ATCGAACCCCTACATTTCATGAGG pLX_317 17.5% 80.6% 81.9% V5 (many diffs) n/a
Download CSV