Transcript: Mouse XM_011244157.2

PREDICTED: Mus musculus nuclear export mediator factor (Nemf), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nemf (66244)
Length:
2811
CDS:
67..2736

Additional Resources:

NCBI RefSeq record:
XM_011244157.2
NBCI Gene record:
Nemf (66244)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244157.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127452 GCTAGGAATGAGAGTAAACAA pLKO.1 129 CDS 100% 5.625 7.875 N Nemf n/a
2 TRCN0000150512 GCTAGGAATGAGAGTAAACAA pLKO.1 129 CDS 100% 5.625 7.875 N NEMF n/a
3 TRCN0000326857 GCTAGGAATGAGAGTAAACAA pLKO_005 129 CDS 100% 5.625 7.875 N Nemf n/a
4 TRCN0000127451 GCTGAAGACATACTCACGTAT pLKO.1 856 CDS 100% 4.950 3.960 N Nemf n/a
5 TRCN0000306406 TCAATGGAAAGGGCTATATAA pLKO_005 791 CDS 100% 15.000 10.500 N Nemf n/a
6 TRCN0000127450 GCTGCTTATCACTTAATCATT pLKO.1 388 CDS 100% 5.625 3.938 N Nemf n/a
7 TRCN0000326789 GCTGCTTATCACTTAATCATT pLKO_005 388 CDS 100% 5.625 3.938 N Nemf n/a
8 TRCN0000127453 GTGGATAACAAGACATATCTT pLKO.1 160 CDS 100% 5.625 3.938 N Nemf n/a
9 TRCN0000326856 GTGGATAACAAGACATATCTT pLKO_005 160 CDS 100% 5.625 3.938 N Nemf n/a
10 TRCN0000127449 GCCAGCATTGAGAACAGTGAT pLKO.1 1342 CDS 100% 4.950 3.465 N Nemf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244157.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.