Transcript: Mouse XM_011244529.1

PREDICTED: Mus musculus SUMO-interacting motifs containing 1 (Simc1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Simc1 (319719)
Length:
4769
CDS:
138..4112

Additional Resources:

NCBI RefSeq record:
XM_011244529.1
NBCI Gene record:
Simc1 (319719)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242138 AGTCACCAAGAGGTATGATTA pLKO_005 1663 CDS 100% 13.200 10.560 N Simc1 n/a
2 TRCN0000242139 GGAGGTGTGCCACAATCATTA pLKO_005 2022 CDS 100% 13.200 10.560 N Simc1 n/a
3 TRCN0000217058 CAAAGTCCTGGAGATCATATT pLKO.1 3662 CDS 100% 13.200 9.240 N Simc1 n/a
4 TRCN0000256989 CAAAGTCCTGGAGATCATATT pLKO_005 3662 CDS 100% 13.200 9.240 N Simc1 n/a
5 TRCN0000200803 GCTCAGATACAAGGACAAATA pLKO.1 2730 CDS 100% 13.200 9.240 N Simc1 n/a
6 TRCN0000257152 TCTGGCCCAGACCCTCTATTT pLKO_005 3722 CDS 100% 13.200 9.240 N Simc1 n/a
7 TRCN0000242140 TGCACTATATGTCCAACATTT pLKO_005 4380 3UTR 100% 13.200 9.240 N Simc1 n/a
8 TRCN0000191974 GCCTATTCAAATTTGGCTTAA pLKO.1 4295 3UTR 100% 10.800 7.560 N Simc1 n/a
9 TRCN0000192179 CCACATATTGGGAGAACCTTT pLKO.1 3995 CDS 100% 4.950 3.465 N Simc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14485 pDONR223 100% 20.9% 21.2% None (many diffs) n/a
Download CSV