Transcript: Mouse XM_011244700.1

PREDICTED: Mus musculus neurolysin (metallopeptidase M3 family) (Nln), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nln (75805)
Length:
4484
CDS:
417..2588

Additional Resources:

NCBI RefSeq record:
XM_011244700.1
NBCI Gene record:
Nln (75805)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031154 CGCGAGCGAATACGCTAAATA pLKO.1 2261 CDS 100% 15.000 21.000 N Nln n/a
2 TRCN0000324280 CGCGAGCGAATACGCTAAATA pLKO_005 2261 CDS 100% 15.000 21.000 N Nln n/a
3 TRCN0000031156 GCACGATTTAGTGGAACAAAT pLKO.1 2010 CDS 100% 13.200 18.480 N Nln n/a
4 TRCN0000324219 GCACGATTTAGTGGAACAAAT pLKO_005 2010 CDS 100% 13.200 18.480 N Nln n/a
5 TRCN0000031158 GCGAACTTACTTCCATGAGTT pLKO.1 1949 CDS 100% 4.950 6.930 N Nln n/a
6 TRCN0000324279 GCGAACTTACTTCCATGAGTT pLKO_005 1949 CDS 100% 4.950 6.930 N Nln n/a
7 TRCN0000031157 GACGACTTCATTGACAGTTTA pLKO.1 1020 CDS 100% 13.200 9.240 N Nln n/a
8 TRCN0000324281 GACGACTTCATTGACAGTTTA pLKO_005 1020 CDS 100% 13.200 9.240 N Nln n/a
9 TRCN0000031155 GCCAGTATTATGGATATCTTT pLKO.1 2365 CDS 100% 5.625 3.938 N Nln n/a
10 TRCN0000324283 GCCAGTATTATGGATATCTTT pLKO_005 2365 CDS 100% 5.625 3.938 N Nln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.