Transcript: Mouse XM_011245071.2

PREDICTED: Mus musculus poly (ADP-ribose) glycohydrolase (Parg), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Parg (26430)
Length:
5174
CDS:
201..2837

Additional Resources:

NCBI RefSeq record:
XM_011245071.2
NBCI Gene record:
Parg (26430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245071.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313246 ACTACTTGGATGGATACTAAA pLKO_005 192 5UTR 100% 13.200 18.480 N Parg n/a
2 TRCN0000126563 GCGATCTTAGGAAACGGTATT pLKO.1 985 CDS 100% 10.800 15.120 N Parg n/a
3 TRCN0000312192 GCGATCTTAGGAAACGGTATT pLKO_005 985 CDS 100% 10.800 15.120 N Parg n/a
4 TRCN0000126560 CGCCTCCATTTGAGAAAGAAA pLKO.1 808 CDS 100% 5.625 7.875 N Parg n/a
5 TRCN0000313245 ATGTTACTTAATGCTAGTATC pLKO_005 3331 3UTR 100% 10.800 8.640 N Parg n/a
6 TRCN0000126562 GCAGTTTCTTACACCTATAAA pLKO.1 569 CDS 100% 15.000 10.500 N Parg n/a
7 TRCN0000312191 GCAGTTTCTTACACCTATAAA pLKO_005 569 CDS 100% 15.000 10.500 N Parg n/a
8 TRCN0000126559 CCTCTCAAAGAGACATCCTAT pLKO.1 2882 3UTR 100% 4.950 3.465 N Parg n/a
9 TRCN0000126561 CCATTCATATACCATGCTGTT pLKO.1 2790 CDS 100% 4.050 2.835 N Parg n/a
10 TRCN0000312193 CCATTCATATACCATGCTGTT pLKO_005 2790 CDS 100% 4.050 2.835 N Parg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245071.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.