Transcript: Mouse XM_011245078.2

PREDICTED: Mus musculus RIKEN cDNA 5031414D18 gene (5031414D18Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rubcnl (271221)
Length:
2766
CDS:
283..2310

Additional Resources:

NCBI RefSeq record:
XM_011245078.2
NBCI Gene record:
Rubcnl (271221)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215764 GTTAGAACTTGGGAAATATAA pLKO.1 1242 CDS 100% 15.000 21.000 N Rubcnl n/a
2 TRCN0000200804 GTACGCATTTAATGCTTTCAA pLKO.1 2434 3UTR 100% 5.625 7.875 N Rubcnl n/a
3 TRCN0000440984 CATAGCCCGGAGACAACATTT pLKO_005 2262 CDS 100% 13.200 10.560 N Rubcnl n/a
4 TRCN0000201390 GCCCTCTTGTACGCATTTAAT pLKO.1 2426 3UTR 100% 15.000 10.500 N Rubcnl n/a
5 TRCN0000429335 GAAGTACCAAGTCAGCGATTT pLKO_005 1767 CDS 100% 10.800 7.560 N Rubcnl n/a
6 TRCN0000191630 GCAGACATCATTATCTCAGTA pLKO.1 964 CDS 100% 4.950 3.465 N Rubcnl n/a
7 TRCN0000201045 CCTCTCATGATGTTACCACAT pLKO.1 2331 3UTR 100% 4.050 2.835 N Rubcnl n/a
8 TRCN0000192984 GCTTGGAATTTCTTCCCACTA pLKO.1 889 CDS 100% 4.050 2.835 N Rubcnl n/a
9 TRCN0000201453 CGGGAAGTCATGCTTAAGTCT pLKO.1 1495 CDS 100% 3.000 2.100 N Rubcnl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.