Transcript: Mouse XM_011245349.1

PREDICTED: Mus musculus UDP glycosyltransferases 3 family, polypeptide A2 (Ugt3a2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ugt3a2 (223337)
Length:
2212
CDS:
416..1600

Additional Resources:

NCBI RefSeq record:
XM_011245349.1
NBCI Gene record:
Ugt3a2 (223337)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422295 CTACTGATGCACCCGAGTTAG pLKO_005 1710 3UTR 100% 10.800 8.640 N Ugt3a2 n/a
2 TRCN0000426906 CTTTATGAAAGTGCTAATATC pLKO_005 312 5UTR 100% 13.200 9.240 N Ugt3a2 n/a
3 TRCN0000437009 TCTTCAGAGGCCTTCCGTAAT pLKO_005 1650 3UTR 100% 10.800 7.560 N Ugt3a2 n/a
4 TRCN0000110413 GCAAGCCATTATATAGTGATA pLKO.1 240 5UTR 100% 4.950 3.465 N Ugt3a2 n/a
5 TRCN0000110414 GTTCCTTGATTTCTCCATGAA pLKO.1 646 CDS 100% 4.950 3.465 N Ugt3a2 n/a
6 TRCN0000426184 ATGATCTTCATTCCTACTTAG pLKO_005 1763 3UTR 100% 10.800 6.480 N Ugt3a2 n/a
7 TRCN0000093992 GCAGCACATCTCAAGCCATAT pLKO.1 1430 CDS 100% 10.800 5.400 Y Ugt3a1 n/a
8 TRCN0000110410 GCATGATTCAGTCCAAGGAAA pLKO.1 942 CDS 100% 4.950 2.475 Y Ugt3a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.