Transcript: Mouse XM_011245351.2

PREDICTED: Mus musculus membrane-associated ring finger (C3HC4) 6 (March6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
March6 (223455)
Length:
6262
CDS:
228..2972

Additional Resources:

NCBI RefSeq record:
XM_011245351.2
NBCI Gene record:
March6 (223455)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285895 CTGTGATCTCAGCGTTGTTTA pLKO_005 3050 3UTR 100% 13.200 18.480 N March6 n/a
2 TRCN0000175382 CGACATGAACTGGAATGCTTT pLKO.1 995 CDS 100% 4.950 6.930 N March6 n/a
3 TRCN0000285899 CGACATGAACTGGAATGCTTT pLKO_005 995 CDS 100% 4.950 6.930 N March6 n/a
4 TRCN0000176141 GCGTCTGCTATATTGTGGTTA pLKO.1 1327 CDS 100% 4.950 6.930 N March6 n/a
5 TRCN0000277270 GCGTCTGCTATATTGTGGTTA pLKO_005 1327 CDS 100% 4.950 6.930 N March6 n/a
6 TRCN0000153535 CGCATCTACAAGTGCTTGTTT pLKO.1 564 CDS 100% 5.625 4.500 N MARCHF6 n/a
7 TRCN0000277268 CACAACGATTGTTGGATATAT pLKO_005 1229 CDS 100% 15.000 10.500 N March6 n/a
8 TRCN0000175235 CTTATGGTTTCTGAGGAATTT pLKO.1 1577 CDS 100% 13.200 9.240 N March6 n/a
9 TRCN0000277269 CTTATGGTTTCTGAGGAATTT pLKO_005 1577 CDS 100% 13.200 9.240 N March6 n/a
10 TRCN0000193266 CCATTTATAGACATCTCCGAA pLKO.1 1642 CDS 100% 2.640 1.848 N March6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07583 pDONR223 100% 89.9% 97.3% None (many diffs) n/a
2 ccsbBroad304_07583 pLX_304 0% 89.9% 97.3% V5 (many diffs) n/a
Download CSV