Transcript: Mouse XM_011245622.2

PREDICTED: Mus musculus tubulin tyrosine ligase-like family, member 8 (Ttll8), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttll8 (239591)
Length:
2752
CDS:
676..2205

Additional Resources:

NCBI RefSeq record:
XM_011245622.2
NBCI Gene record:
Ttll8 (239591)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193819 CGATGATATCCACGATGTGAT pLKO.1 1449 CDS 100% 4.950 6.930 N Ttll8 n/a
2 TRCN0000438879 TACGGGAAGACAGCATCATTC pLKO_005 1570 CDS 100% 10.800 7.560 N Ttll8 n/a
3 TRCN0000415595 GTCTTTGTGACTTGGTGTAAA pLKO_005 547 5UTR 100% 13.200 6.600 Y Acsf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.