Transcript: Mouse XM_011245647.2

PREDICTED: Mus musculus Rac GTPase-activating protein 1 (Racgap1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Racgap1 (26934)
Length:
2865
CDS:
167..1972

Additional Resources:

NCBI RefSeq record:
XM_011245647.2
NBCI Gene record:
Racgap1 (26934)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245647.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023950 CGTCTCAAAGACGGTTATTAA pLKO.1 955 CDS 100% 15.000 21.000 N Racgap1 n/a
2 TRCN0000322156 CGTCTCAAAGACGGTTATTAA pLKO_005 955 CDS 100% 15.000 21.000 N Racgap1 n/a
3 TRCN0000023951 CGCCGGATGGAGATTATCAAT pLKO.1 148 5UTR 100% 5.625 7.875 N Racgap1 n/a
4 TRCN0000023949 CCGGCAACAATAGACTGTCAA pLKO.1 501 CDS 100% 4.950 6.930 N Racgap1 n/a
5 TRCN0000023952 CCTGTCACAGAGGTTGTACAA pLKO.1 1855 CDS 100% 4.950 6.930 N Racgap1 n/a
6 TRCN0000322219 CCTGTCACAGAGGTTGTACAA pLKO_005 1855 CDS 100% 4.950 6.930 N Racgap1 n/a
7 TRCN0000322222 ACCTCTTAGGTAACGTCTTAG pLKO_005 2305 3UTR 100% 10.800 7.560 N Racgap1 n/a
8 TRCN0000322221 AGCTGAAGCATGCCCGTAATC pLKO_005 300 CDS 100% 10.800 7.560 N Racgap1 n/a
9 TRCN0000322158 CTTCCGAAAGAAGTATCAAAG pLKO_005 205 CDS 100% 10.800 7.560 N Racgap1 n/a
10 TRCN0000023953 CCATTGAAGCTGTGTCTACTA pLKO.1 774 CDS 100% 4.950 3.465 N Racgap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245647.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.