Transcript: Mouse XM_011245943.2

PREDICTED: Mus musculus neurexophilin and PC-esterase domain family, member 3 (Nxpe3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nxpe3 (385658)
Length:
4346
CDS:
1624..3366

Additional Resources:

NCBI RefSeq record:
XM_011245943.2
NBCI Gene record:
Nxpe3 (385658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283431 GGTTCAAGATGCGCCACTTTA pLKO_005 2690 CDS 100% 13.200 18.480 N Nxpe3 n/a
2 TRCN0000267060 TTCGCTTCACGAGCGTCTTTA pLKO_005 2921 CDS 100% 13.200 18.480 N Nxpe3 n/a
3 TRCN0000267059 CAAGAAGTATGGCGGAGATTA pLKO_005 2031 CDS 100% 13.200 10.560 N Nxpe3 n/a
4 TRCN0000283434 GAAACCAGACAGGGTCTATTT pLKO_005 2232 CDS 100% 13.200 9.240 N Nxpe3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04561 pDONR223 100% 82.1% 85.1% None (many diffs) n/a
2 ccsbBroad304_04561 pLX_304 0% 82.1% 85.1% V5 (many diffs) n/a
3 TRCN0000475967 GTGGCCAGCGACCTAGCGTTCGGT pLX_317 18.2% 82.1% 85.1% V5 (many diffs) n/a
Download CSV