Construct: ORF TRCN0000475967
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010383.1_s317c1
- Derived from:
- ccsbBroadEn_04561
- DNA Barcode:
- GTGGCCAGCGACCTAGCGTTCGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NXPE3 (91775)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475967
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NM_001134456.2 | 100% | 100% | |
| 2 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NM_001348990.2 | 100% | 100% | |
| 3 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NM_001348991.2 | 100% | 100% | |
| 4 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NM_001348992.2 | 100% | 100% | |
| 5 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NM_001348993.2 | 100% | 100% | |
| 6 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NM_001348994.2 | 100% | 100% | |
| 7 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NM_001348995.2 | 100% | 100% | |
| 8 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NM_145037.4 | 100% | 100% | |
| 9 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NM_001348996.2 | 87.6% | 87.6% | 920_921ins207 |
| 10 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NM_001348997.2 | 87.6% | 87.6% | 920_921ins207 |
| 11 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NM_001348998.2 | 87.6% | 87.6% | 920_921ins207 |
| 12 | human | 91775 | NXPE3 | neurexophilin and PC-estera... | NR_145993.2 | 18.7% | 1_611del;1457_1458ins74;2215_8494del | |
| 13 | mouse | 385658 | Nxpe3 | neurexophilin and PC-estera... | NM_001134457.1 | 85.2% | 88.5% | (many diffs) |
| 14 | mouse | 385658 | Nxpe3 | neurexophilin and PC-estera... | XM_006522325.3 | 85.2% | 88.5% | (many diffs) |
| 15 | mouse | 385658 | Nxpe3 | neurexophilin and PC-estera... | XM_011245941.2 | 82.1% | 85.1% | (many diffs) |
| 16 | mouse | 385658 | Nxpe3 | neurexophilin and PC-estera... | XM_011245942.2 | 82.1% | 85.1% | (many diffs) |
| 17 | mouse | 385658 | Nxpe3 | neurexophilin and PC-estera... | XM_011245943.2 | 82.1% | 85.1% | (many diffs) |
| 18 | mouse | 385658 | Nxpe3 | neurexophilin and PC-estera... | XM_011245944.2 | 82.1% | 85.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1743
- ORF length:
- 1677
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg gaccaatttc ttcaaactac ggcttttctg ctgtctgctt gcagtgttga 121 tggtggtggt gctggtcatc aatgttactc aggtagagta cttggaccat gagactgttt 181 cagccacttt catcgacagc agtggacagt ttgtttcctc ccaggtgaca ggaattagcc 241 gaaatcccta ctgtggctat gatcagcaga ccctgtccag ccaggagcgc atggaggagg 301 actccttgct ggctgccttg caccggcagg ttcctgatgt gggcccagtc ccctttgtga 361 agagcactga cccttcttcc agctactttg tcatcttgaa ctctgctgcc ttctttaagg 421 tgggaagcca gcttgaggtg ctggttcatg tgcaggattt tcaaagaaag cccaagaagt 481 atggtggaga ctacctgcag gccagaattc actccctcaa gctgcaggct ggggctgtgg 541 gcagggtggt ggattaccag aatgggtttt acaaggtttt ctttactttg ctatggccag 601 gcaaagttaa agtatccgta tctctggtcc accccagtga agggatcaga gttcttcagc 661 gcttacagga agataaacca gacagggtct atttcaagag tctcttccgt tcaggaagaa 721 tttctgaaac tactgagtgc aacgtgtgtc ttcctgggaa tctgcccctg tgtaacttta 781 cagacctcta cactggggag ccctggttct gcttcaaacc aaagaagctc ccttgcagca 841 gcagaattac ccatttcaaa ggtggatacc tgaaaggtct cctaaccgct gcagagagtg 901 ctttcttcca gagtggtgtc aatatcaaaa tgccagtcaa ctccagtgga cctgattggg 961 taactgtgat tcccaggaga ataaaagaaa ctaacagtct agaactatct caaggctcag 1021 gaacttttcc ttctgggtat tattataaag accagtggag gcccagaaag tttaagatgc 1081 gtcagtttaa tgaccctgac aacattacag agtgcttaca aagaaaagtg gtgcatttat 1141 ttggtgactc aacaatcagg caatggtttg aataccttac tacatttgtt ccagatttag 1201 tggagtttaa cttgggtagt cccaagaatg tgggtccctt ccttgcagtg gaccagaagc 1261 acaacatcct gctcaaatac cgctgccatg gtccacccat ccgcttcacg actgtcttta 1321 gcaatgagct ccattatgtg gcgaatgagc tgaatggcat tgtgggaggg aagaacacag 1381 tggttgccat agctgtatgg tctcacttca gcaccttccc tttggaagtg tacatccggc 1441 ggcTCAGGAA CATCCGTCGA GCAGTGGTTC GGCTCCTCGA TCGAAGCCCA AAGACCGTGG 1501 TGGTCATCCG GACGGCCAAC GCCCAAGAGC TGGGACCTGA GGTGAGCCTT TTCAACAGCG 1561 ACTGGTACAA CTTTCAGCTG GACACCATCC TTCGGAGGAT GTTCTCAGGG GTTGGAGTAT 1621 ATCTCGTCGA TGCCTGGGAG ATGACCCTGG CCCATTATCT ACCGCACAAG CTGCATCCAG 1681 ATGAAGTTAT TGTGAAGAAC CAGCTGGACA TGTTCTTGTC CTTTGTGTGC CCCTTGGAAA 1741 CCTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1801 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1861 GGCTTTATAT ATCTTGTGGA AAGGACGAGT GGCCAGCGAC CTAGCGTTCG GTACGCGTTA 1921 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt