Transcript: Mouse XM_011246050.1

PREDICTED: Mus musculus GLIS family zinc finger 2 (Glis2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Glis2 (83396)
Length:
1594
CDS:
50..877

Additional Resources:

NCBI RefSeq record:
XM_011246050.1
NBCI Gene record:
Glis2 (83396)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246050.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304540 TTCCAGCCACTTCGCTATTTG pLKO_005 398 CDS 100% 13.200 9.240 N Glis2 n/a
2 TRCN0000082233 GCCAAGTGTAACCAGCTCTTT pLKO.1 566 CDS 100% 4.950 3.465 N Glis2 n/a
3 TRCN0000301893 GCCAAGTGTAACCAGCTCTTT pLKO_005 566 CDS 100% 4.950 3.465 N Glis2 n/a
4 TRCN0000082234 GCCAGGTACAAGATGCTCATT pLKO.1 701 CDS 100% 4.950 3.465 N Glis2 n/a
5 TRCN0000331777 GCCAGGTACAAGATGCTCATT pLKO_005 701 CDS 100% 4.950 3.465 N Glis2 n/a
6 TRCN0000082236 GACCATCATGTCAAGCCTGAA pLKO.1 620 CDS 100% 4.050 2.835 N Glis2 n/a
7 TRCN0000301892 GACCATCATGTCAAGCCTGAA pLKO_005 620 CDS 100% 4.050 2.835 N Glis2 n/a
8 TRCN0000082235 CCTAAAGCTGAGCATCACCAA pLKO.1 76 CDS 100% 2.640 1.848 N Glis2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246050.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.