Transcript: Mouse XM_011246087.2

PREDICTED: Mus musculus synaptojanin 1 (Synj1), transcript variant X16, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Synj1 (104015)
Length:
5074
CDS:
633..4997

Additional Resources:

NCBI RefSeq record:
XM_011246087.2
NBCI Gene record:
Synj1 (104015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081207 CCGAACACTTAAGGACTTATA pLKO.1 1922 CDS 100% 13.200 18.480 N Synj1 n/a
2 TRCN0000081204 GAGTTTATATCATTGCGAGTT pLKO.1 1368 CDS 100% 4.050 5.670 N Synj1 n/a
3 TRCN0000081205 CCTTCCGAATGAAGAGGTTAA pLKO.1 3281 CDS 100% 10.800 8.640 N Synj1 n/a
4 TRCN0000080653 CGCTTCTAACTACTGGAAGTT pLKO.1 2557 CDS 100% 4.950 3.960 N Synj1 n/a
5 TRCN0000081203 GCCAACTGATATATTTGCAAT pLKO.1 2813 CDS 100% 4.950 3.960 N Synj1 n/a
6 TRCN0000080656 GAGGCTATTAAAGGCACATAT pLKO.1 1203 CDS 100% 13.200 9.240 N Synj1 n/a
7 TRCN0000080655 GCCTTGATTGACATAGATATA pLKO.1 3663 CDS 100% 13.200 9.240 N Synj1 n/a
8 TRCN0000081206 AGGAGTTTCAAGATAAGAGAA pLKO.1 2788 CDS 100% 4.950 3.465 N Synj1 n/a
9 TRCN0000080654 CCCATCGTGTTCGTATGTCAA pLKO.1 1861 CDS 100% 4.950 3.465 N Synj1 n/a
10 TRCN0000049969 CCGAGTTACTTCCACTGAGTT pLKO.1 1352 CDS 100% 4.950 3.465 N SYNJ1 n/a
11 TRCN0000288982 CCGAGTTACTTCCACTGAGTT pLKO_005 1352 CDS 100% 4.950 3.465 N SYNJ1 n/a
12 TRCN0000080657 GAACAAATAGTGTGCAGGCAT pLKO.1 2230 CDS 100% 2.640 1.848 N Synj1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.