Transcript: Mouse XM_011246104.1

PREDICTED: Mus musculus potassium inwardly-rectifying channel, subfamily J, member 6 (Kcnj6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnj6 (16522)
Length:
2206
CDS:
275..1498

Additional Resources:

NCBI RefSeq record:
XM_011246104.1
NBCI Gene record:
Kcnj6 (16522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069813 CCATTGATTATTAGCCATGAA pLKO.1 1052 CDS 100% 4.950 6.930 N Kcnj6 n/a
2 TRCN0000069816 GACGTGGCAAACCTAGAGAAT pLKO.1 1463 CDS 100% 4.950 6.930 N Kcnj6 n/a
3 TRCN0000069817 CTAACGTCTTGGAAGGCGATT pLKO.1 252 5UTR 100% 4.050 5.670 N Kcnj6 n/a
4 TRCN0000044410 CGAAGTTGACTACAACAGCTT pLKO.1 1267 CDS 100% 2.640 3.696 N KCNJ6 n/a
5 TRCN0000069815 CGCCTTCATGGTAGGATGTAT pLKO.1 772 CDS 100% 5.625 4.500 N Kcnj6 n/a
6 TRCN0000069814 GCCAAGTTGATCAAGTCCAAA pLKO.1 941 CDS 100% 4.950 3.465 N Kcnj6 n/a
7 TRCN0000427449 TCAGAGCCAAGTTGATCAAAT pLKO_005 936 CDS 100% 13.200 9.240 N KCNJ6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06478 pDONR223 100% 86.9% 95.5% None (many diffs) n/a
2 ccsbBroad304_06478 pLX_304 0% 86.9% 95.5% V5 (many diffs) n/a
Download CSV