Transcript: Mouse XM_011246459.2

PREDICTED: Mus musculus thyroid adenoma associated (Thada), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Thada (240174)
Length:
4620
CDS:
187..4041

Additional Resources:

NCBI RefSeq record:
XM_011246459.2
NBCI Gene record:
Thada (240174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339330 GGGTAAAGCAAGGCTTAATTC pLKO_005 2033 CDS 100% 13.200 18.480 N Thada n/a
2 TRCN0000217718 GTATCAGCTGAGTCATGATAT pLKO.1 2487 CDS 100% 1.320 1.056 N Thada n/a
3 TRCN0000339331 GAGATCTTATGTGATTGATTA pLKO_005 1809 CDS 100% 13.200 9.240 N Thada n/a
4 TRCN0000339328 TGTCGTCTGTTTGCAACATTC pLKO_005 2354 CDS 100% 10.800 7.560 N Thada n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.